The Narrative Collapsing - A Scathing Attack on the Israeli Ministry of Health by Professor Ehud Qimron, head of the Department of Microbiology and Immunology at Tel Aviv University

raven9 · 2022-01-28T23:21:54+00:00

Prison is used to prevent non compliants and other undesirables from breeding.

raven9 · 2022-01-26T17:13:42+00:00

The mRNA vaccines solicit the immune system to make antibody specific to the spike protein (S-IgG). In early 2019, research into the original SARS virus found the cause of the severe respiratory disease in SARS was an immune system dysfunction caused by S-IgG antibody.

Anti–spike IgG causes severe acute lung injury by skewing macrophage responses during acute SARS-CoV infection

The researchers found the presence of S-IgG antibody in patients who had not yet cleared the virus, caused a heightened immune system inflammatory response while suppressing the healing response. This left the patient with severe Acute Lung Injury (ALI).

Would anyone have take those vaccines to SARS-2 if they had known they will flood their body with the same antibody type that was identified as the cause of immune dysfunction and death in SARS-1?

You might say well that was SARS-1, it does not mean the same thing occurs in SARS-CoV-2/Covid and that would be a good point but there is a problem with that...

Doctors who treated thousands of SARS-CoV-2 patients noted that day 8 after symptom onset is the turning point. Patients who had not cleared the virus by day 8 took a turn for the worse. Dr. Chankra Chetty was one of the first to notice this. He treated over 4000 Covid19 patients in S.Africa he described day 8 as the onset of the inflammatory phase. He said,

"Very early on, I understood that the dyspnea (shortness of breath) that sets in seems to have a specific time in the disease. It was very quick in onset, there was differences in speed and severity, but it always seemed to present on the 8th day.” “Some of the patients recovered by the 7th day and had none of the symptoms that occurred from the 8th day onwards.” - Dr. Chankra Chetty -

Now the kicker - Day 8 was the very same day that IgG antibody was first detected in Covid19 patients. I say "was" because now the majority of the population is already flooded with vaccine induced S-IgG so it is present from day zero.

Bottom line - Expect vaccinated patients to enter inflammatory phase covid within hours of infection.

raven9 · 2022-01-25T18:48:32+00:00

Lice, overcrowded dormitories and the fact it was before antibiotics.

raven9 · 2022-01-25T02:49:05+00:00

Yep I think they did the same thing to all of us that posted on conspiracy. That reminds me... Did you notice /r/conspiracytheory has been abandoned? The last new post was 2 years ago. I tried to get it but if course reddit would not give it to me....

raven9 · 2022-01-25T02:38:38+00:00

The trouble is if saidit was to become a major player in the information wars, you would be targetted by the same troll farms and corporate shills that has made reddit so toxic.

raven9 · 2022-01-25T02:30:31+00:00

I think if you ever post on /r/conspiracy your account is marked and you are targetted for vote capping.

raven9 · 2022-01-24T17:51:34+00:00

Sometimes people write about things they have known for a long time.

raven9 · 2022-01-24T00:08:20+00:00

There is more than one Joe Biden. There's "Dementia" Joe that slurs some words especially if they have more than two syllables then theres the "George Clooney" Joe with the deeper clearer voice.

raven9 · 2022-01-23T19:56:48+00:00

I think we are seeing that fallout. I suspect the unvaxxed would not have experienced any real difference between the current and previous variants. I think the difference is caused by the presence of the vaccine induced S-IgG antibodies. Instead of helping, they are making it worse just like S-IgG did in the original SARS outbreak.

I mean think about it. Why would they create vaccines to SARS-2 that isolate the spike protein and use it to solicit production of the very same antibody type that was identified as the cause of the severe disease in SARS-1 unless the purpose was nefarious?

raven9 · 2022-01-23T14:56:21+00:00

We know the vaccine doesn't work now, time to implement reality.

Oh you wait and see what happends. I already posted about this but no one seemed interested. What we are seeing right now is exactly what we would expect to see if the acute respiratory distress syndrome is caused by the same thing it was in the original SARS disease.

S-IgG antibodies. Antibodies specific to the spike protein in SARS caused immune system dysfunction. A heightened Inflammatory response combined with a suppressed healing response and it caused Acute Lung Injury.

So now we have a population flooded with vaccine induced S-IgG. The very same antibody that triggered the onset of severe respiratory disease in SARS. I seem to be the only one that recognised this and no one is listening.

raven9 · 2022-01-22T02:33:45+00:00

Because the ONLY reason Wuhan was in the frame in the first place was because in Dec 2019 their hospital was the first to notice they had patients with a new virus. For that reason alone they were blamed for being the origin.

So now we know those patients in Wuhan hospital in December were far from being the first to have the virus so therefore evidence was being contrived to blame Wuhan when there was no credible reason to do that. When you put all of that together it says this is a set up.

Aside from that Italy wasnt a couple of months earlier. It was several months earlier.

raven9 · 2022-01-21T23:56:18+00:00

I think you are about to see the result of their biggest lie of all time. Their claim that their vaccines reduce covid symptoms.

No one seemed to noticed that research into the original SARS-1 virus found the main cause of the respiratory disease was a severe adverse effect triggered by the presence of S-IgG antibodies. (S-IgG are antibodies specifically to the spike protein).

So they make vaccines to the SARS-2 virus that solicit a flood of spike protein antibodies knowing that was the cause of severe acute lung injury in SARS-1 and they claim that will reduce symptoms? Please.

Right now in the U.S. we are seeing 800,000 new cases per day and that's just those who got tested and we are seeing deaths back up in the thousands per day. This is just the beginning.

raven9 · 2022-01-21T22:53:52+00:00

The fact you do not understand the significance of 9 million Americans calling out sick at the same time tells me all I needed to know.

raven9 · 2022-01-21T16:45:41+00:00

https://i.redd.it/lceofsad2vl51.jpg

raven9 · 2022-01-21T16:39:48+00:00

So how do you explain the 9 million Americans that are out of work sick right now?

raven9 · 2022-01-21T16:37:45+00:00

Yes get bimectin, it is the same as Ivermectin but packaged for use on 1200lb horses so remember to base your dose on your human weight.

raven9 · 2022-01-20T20:28:56+00:00

Scientifically speaking whites have never been considered to be a race. They belong to the caucasian race which includes people from Europe, parts of Asia and North Africa so skin color eye color and hair color vary widely.

raven9 · 2022-01-20T03:09:11+00:00

Yeah they have been doing that. It seems they have a system that vote caps new posts based on their subject so the ones they want to suppress just forum slide down to oblivion.

raven9 · 2022-01-20T02:22:19+00:00

This is because the WHO, The CDC, Fauci, the global corporations and all our governments and health authorities have always wanted this virus to infect everyone. I don't know how anyone still doesn't see that. It was obvious to me since early 2020 when they pulled all the N95 masks from the stores and made zero effort to replace them. Not a single attempt to create an N95 production line anywhere in the entire United States even though we now know the Director General of the WHO said the virus was airbourne in a closed meeting in Geneva in Feburary 2020. We have been watching a concerted and deliberate effort at massive depopulation but most just dont know it yet.

raven9 · 2022-01-20T00:33:01+00:00

Oh yeah great. Just what the world needs. More psychopaths in congress.

raven9 · 2022-01-19T23:16:58+00:00

Neither. I present the truth for free.

raven9 · 2022-01-19T21:03:26+00:00

Hmmm yeah... There is something weird going on for sure. The way they went all out to prevent and discredit Ivermectin seems insane. Even if they really believed it did not work then so what? People would soon have found that out for themselves if it were true.

raven9 · 2022-01-19T19:40:51+00:00

I think this site is more suppressed than censored. Even just a cursory look at the main saidit.net page reveals there is no proper way to access subs that are not in the main subs list and even they are tucked away from view under the my subs button. You might know someone started a sub called coronavirus. Good luck with finding a way to get to it from the main saidit.net page. Why would anyone who wanted to make the site better than reddit just ignore details like that?

raven9 · 2022-01-19T18:22:11+00:00

Wow. I have not seen any of that in the US since mid 2020 except some people had to wear masks at work but thats about all.

raven9 · 2022-01-19T14:26:36+00:00

So what about the freezing January weather? Is that not going to be an issue for a road block protest?

raven9 · 2022-01-19T06:03:32+00:00

Election fraud.

raven9 · 2022-01-18T20:57:15+00:00

Neuroscientist Kevin McCairn predicted this would happen.

raven9 · 2022-01-18T20:20:48+00:00

Only leftists would say mask wearing is a political badge.

raven9 · 2022-01-18T20:15:03+00:00

This is just zio-fascist jews banning people for pointing out the bullshit that another zio-fascist Jew said.

raven9 · 2022-01-18T16:30:49+00:00

That they will fit in better if they are a fascist psychopath and a pedophile.

raven9 · 2022-01-18T15:32:36+00:00

Damn..100lbs in one year has to be dangerous.

raven9 · 2022-01-18T14:47:33+00:00

The real allergen type masks and medical masks do work but they are made of filtration media. I dont see where there was any science that said a piece of spandex does the same thing

raven9 · 2022-01-18T04:59:43+00:00

The trouble is, that is also what you would expect to see if someone had been trolling the VAERS system. They would likely only know one legitimate batch number to use.

raven9 · 2022-01-18T02:02:20+00:00

I don't know why anyone would have believed those flimsy fabric masks did anything to begin with. They even say on their labels that they are not designed to protect from virus.

raven9 · 2022-01-18T01:10:27+00:00

The MP40 in that video looks like it had been converted to semi auto. The original MP40 has a much faster rate of fire.

raven9 · 2022-01-18T00:59:09+00:00

I would not doubt for 1 second that there is something in that vaccine to induce psychopathy.

raven9 · 2022-01-18T00:37:10+00:00

Its not propaganda. You don't have to trawl through hundreds of research papers to find propaganda.

The propaganda is the mainstream media version which says the only thing to be concerned about is the respiratory symptoms and getting vaccinated.

raven9 · 2022-01-17T17:42:53+00:00

I still have a nagging doubt about all of it. I really think the virus does something permenant to the immune system. I hope I am wrong but the research I read strongly suggests the respiratory symptoms are just an initial inflammatory response.

raven9 · 2022-01-17T15:43:53+00:00

I wonder if we are specifically speaking about the United States here?

Yeah I was speaking in general about the system of big pharma medications and doctors who prescribe them here in the US. I had not considered whether doctors in other countries are more or less likely to prescribe those medicines with psycological side effects or not.

raven9 · 2022-01-17T02:48:48+00:00

Yes. As long as there are polar ice caps we are in ice age.

raven9 · 2022-01-16T14:58:48+00:00

Ok, but this is literally true for even the brown races. In fact, guess which country people would rather flee en masse? Mexico or the USA?

The one that the CIA turned into a lawless drug trafficking hub for the tons of Marijuana, cocaine and meth they import into the US every week.

raven9 · 2022-01-16T14:20:01+00:00

I meant if the copyright owner decided to sue. You would be on shakey ground in court if you tried to claim fair use if you profit from it.

raven9 · 2022-01-16T14:16:17+00:00

So you claim to be a Jew but you never heard of the Havaara agreement Hitler signed with the Rothschilds in 1933? You never heard of Britain's 1939 white paper for Palestine that put a stop to it?

I never said the British put them in concentration camps. They were called Havaara camps. Havaara means transfer in Hebrew. The Havaara company was established in Tel Aviv after Hitler and the Zionist leaders in Europe signed the Havaara Agreement to move the European Jews to Palestine. They were doing that until the British put a stop to it and left Germany with Havaara camps full of Jews with nowhere to send them.

raven9 · 2022-01-16T13:41:35+00:00

You could create a key pair and publish the public key so then when you make a post anywhere else you could make a SHA1 hash of it and encrypt that and post it along with your post. Anyone with your public key could decrypt the hash and verify it matches their own hash of your post. That proves you are the one who encrypted it hence proof of the same identity. That would also mean other people could encrypt messages to you with your public key.

raven9 · 2022-01-16T05:10:29+00:00

Yes that sounds good too, I didn't know a signature can be verified with just a hash of the public key.

raven9 · 2022-01-16T04:56:15+00:00

I never suggested they don't know about coding. I said their login method is a nuisance.

raven9 · 2022-01-16T04:21:26+00:00

8) Should we just move to one of the new blockchain based startups

raven9 · 2022-01-16T03:09:04+00:00

There was a holocaust but not for the reason the history says. Those records were kept because all those people were there in the process of being transferred to Palestine. The holocaust happened because the British who were in charge in Palestine put a stop to the immigration in response to the actions of the Jew paramilitary Terrorist group, The Irgun who were trying to force the indigenous Palestinians out. The result was WW2 and overcrowded transfer camps full of Jews with nowhere to send them. Conditions in those transfer camps rapidly deteriorated and they became horrific disease ridden ghettos where typhoid, starvation, murder and canniblism became the norm.

THAT was the reason for the holocaust and all of that is also documented.

raven9 · 2022-01-16T02:10:54+00:00

No one on that Twitter thread seems to have noticed this patented sequence is part of the same RNA sequence that back in February 2020 the scientists from the University of New Delhi identified as the forth HIV-1 insert in the SARS-CoV-2 Spike Protein Genome. That RNA sequence translated to the protein sequence QTNSPRRA

That 4th Insert sequence aligned over this patented sequence:

CAGACTAATTCTCCTCGGCGGGCA
..........CTCCTCGGCGGGCACGTAG

raven9 · 2022-01-15T15:53:55+00:00

I think this is the tip of an iceberg that represents a level of mental illness that pervades this country at every level. Sick twisted psychopaths who slime their way into positions of authority and then use that authority to persecute others. That is all they want. They thrive on the power that victimizing others gives them.

raven9 · 2022-01-15T04:51:01+00:00

Thats not myocarditis rates, this is the number of google searches with the search term myocarditis.

raven9 · 2022-01-14T22:37:37+00:00

Watch the mainstream media blame the spike in autoimmune disease on things like fast food.

raven9 · 2022-01-14T21:23:10+00:00

You seem to be confusing the term world power with some kind of claim to superiority. Any and every civilization that has ever considered themselves to be world power or world leader has a despicable and shameful history of psychopathic and genocidal leadership that has massacred their way around the world. It is definately not something to be proud of. Our modern history tells the same story. Just ask the people of Vietnam, Korea, Iraq, Afghanistan, Yemen, Syria etc about the supposed world leadership of the criminal regime that calls themselves the United States Government and the CIA.

raven9 · 2022-01-14T16:02:28+00:00

Yeah Odysee does that. Github started doing it too. It is very much a nuisance having to sign in to email to get that link every time.

raven9 · 2022-01-14T15:43:29+00:00

It's not really very awesome. It just means you have to sign into your email instead to receive the link... Steve Gibson invented a good solution but I have yet to see anyone implement it.

When you sign up, your app would generate an encryption key pair and send the public key to the host site. They store that key. In future, whenever you log in, you just enter your username. The site responds by using your public key to encrypt some random text which it sends to your app. Your app uses your private key to decrypt it and sends the plain text back to the site, encrypted with your private key. The host site decrypts it with the public key. If it matches the random text they encrypted and sent, you are logged in. No need to remember any passwords.

raven9 · 2022-01-14T15:39:44+00:00

I am suspicious of sites like Odysee and Rumble that monetize uploads. The fair use of copyrighted material rules are very much about non profit use. If you use any copyrighted video in your upload and you profit from it you can't claim fair use.

On top of that Odysee demands your phone number before you can receive their crypto currency which you need because you also get charged a fee for each upload.

raven9 · 2022-01-14T02:13:14+00:00

Hitler probably said something a lot like that.

raven9 · 2022-01-13T17:03:37+00:00

I have believed all along it all began on June 30, 2019 with an outbreak of a respiratory disease that hospitalised 23 people and killed 3 of them. They were all from the Greenspring assisted living center in Fairfax County Virginia which is 45 minutes away from the level 4 bioweapons labs across the state line at Ft Detrick, Maryland.

At the same time as that outbreak at Greenspring was being investigated, on July 15, the CDC issued a cease and desist order to shut down those bio-labs at Ft. Detrick. It was later admitted there had been breaches of containment (of course they claimed there was no threat to the public).

On July 17, two days after those labs were shut down, Fairfax County announced the CDC had analysed 17 samples from those hospitalized patients but claimed they could not identify a pathogen.

On July 29, Fairfax County released an update that said, "Results of earlier testing submitted to the Centers for Disease Control and Prevention indicated rhinovirus, a virus that causes the common cold."

So we are to believe, for all those weeks, all the resources of the CDC were unable to identify the common cold rhinovirus? LoL.

I think it is more than obvious what really happened. Then about 3 weeks later in August they announced stage 2 of the cover-up. Vaping Illness.

raven9 · 2022-01-11T16:06:36+00:00

This is probably because the virus already damaged her immune system.

raven9 · 2022-01-11T02:35:06+00:00

Yeah this all lead me to believe Yeadon and Co are not as smart as they think they are because there is a very obvious alternative explanation for the large clusters of adverse effects with the same batch numbers. If bad actors were entering false reports into the system they would have a limited number of real batch numbers to use in their reports....

raven9 · 2022-01-10T19:48:05+00:00

He can he just doesnt want to. Every year a similar number of people die. The number of deaths over and above that number died of something new.

raven9 · 2022-01-10T19:45:31+00:00

Hate for people who did nothing to you is mental illness.

raven9 · 2022-01-09T20:01:51+00:00

We might never know the truth about that. All it would take is one scientist to either steal a virus sample or accidentally get infected so an attack could just as easily be disguised as an accident as an accident could be mistaken for an attack.

raven9 · 2022-01-07T23:31:19+00:00

I tried but Android Studio crashes my laptop. I was looking at an Android based IDE called AIDE that actually runs on a phone. I downloaded it I am going to try to figure out how to import a project from github and see what happens.

raven9 · 2022-01-07T22:58:19+00:00

We'll see. I think history will show the greater agenda always was to create a "blame hole" to carry the can for the bio-nazi's that caused all of it. First they tried to blame it on vaping. That was before anyone realized the enormity of what they had done. Then they tried to blame it on China but they soon realized they were "going to need a bigger boat" to handle this one. Something like shooting up the entire worlds population with liability exempt, emergency use vaccines that could be blamed for anything and everything their bioweapon does and so none of the real perpetrators would be held responsible. We all know who these people are and they are smart enough to know their future depends on the historical record.

raven9 · 2022-01-07T22:29:49+00:00

You are probably right over the target.

raven9 · 2022-01-06T20:30:12+00:00

Happy New Year!!

raven9 · 2022-01-06T20:09:56+00:00

Wear tight pants.

raven9 · 2022-01-06T04:47:22+00:00

You might try just keeping the saidit app updated. Redreader just put out version 1.18 with a ton of updates.

raven9 · 2022-01-05T04:56:22+00:00

The global tech fascists decided it was their job to control what the people should discuss amongst themselves.

raven9 · 2022-01-04T00:14:48+00:00

Is there any evidence the interest in this extended outside the community that already knew what Malone has been saying?

raven9 · 2022-01-02T23:14:16+00:00

what attracts people to a site is the ability to grow a community and..

No it's not. I am interested in posting discussion topics and sharing information I am not interested in "growing a community". That kind of thing is for narcissistic psychopaths who crave control.

raven9 · 2022-01-02T20:28:51+00:00

LoL. They are trying to blue pill everyone. They are trying to take back the redpill and replace it with something less threatening to the globalist cabal.

raven9 · 2022-01-02T16:55:54+00:00

Zionist should be on the list. Just because all jews are not zionist doesn't mean people dont use it as a altermative way to say jew.

raven9 · 2021-12-22T03:36:32+00:00

Answer: Because you are the one who sold out to google.

raven9 · 2021-12-01T03:00:31+00:00

Steve Kirsch is pointing to Vaers data that shows 24 cases of CJD amongst those vaccinated for covid19 and claiming that is proof the covid19 vaccine causes CJD. The usual rate of CJD in the US is 1 per million or 350 cases per year. As at least 60% of the population have been vaccinated we would expect to see around 200 cases of CJD that were also vaccinated.

Steve Kirsh therefore demonstrates the danger of building false corrolations and jumping to conclusions without checking what the expected base levels are first.

raven9 · 2021-11-13T05:45:22+00:00

What if those they called fascists and nazis never were insane but the story we were told was?

raven9 · 2021-10-22T13:18:28+00:00

I think it would be more active if someone would fix the app's push notifications so people know they have replies to respond to.

raven9 · 2021-10-18T18:51:37+00:00

IQ tests were designed to be a one off event so the test subject would be using purely their deductive ability to interpret the questions and calculate the answers and not be able to use prior knowlege. As this test is online anyone can take it multiple times and enhance their pattern recognition skills by repeated practice thereby making it a test of pattern recognition skills and invalidating it as a measure of overall intelligence.

raven9 · 2021-10-18T02:47:43+00:00

When it looks like an animal and it behaves like an animal it probably is an animal.

raven9 · 2021-10-17T22:48:49+00:00

Hitler and the Zionist leaders had already signed the Haavara agreement in 1933.

raven9 · 2021-10-17T19:08:31+00:00

They have been doing things like this since the 1930s. It is why the British Government stopped Hitler from sending the Jews there in 1939. That was the real reason for WW2. Hitler had a lot staked on the Havaara program that he signed with the European Zionist leaders because they agreed that the Jews would give up their property and businesses in Germany and in return Hitler would ship them all to Palestine. The problems started when the Jewish immigrants started terrorist bombings and shootings in Palestine in an effort to run the Palestinians off. The British authorities that had been in charge of Palestine since the end of WW1 found themselves stuck in the middle between Jew terrorist groups and outraged Arabs. In 1939 the British Government had enough and published what is known as the white paper on Palestine which heavily restricted Jewish immigration. This left Hitler stuck with hundreds of thousands of Jews in the Havaara camps in Germany and nowhere to send them. That was the real reason why WW2 started. Hitler's only option was to try take control of the middle east but the British were occupying countries all around the region. The first thing Hitler did was to take out Britain's allies on Germany's borders, Poland and France. Then he attacked Britain's forces in N.Africa.

raven9 · 2021-10-17T17:04:15+00:00

How ironic. British politicians think they can still have the kind of open meetings with the public like they did when Britain was a civilized well mannered country. They need to realize THEY are the ones who kicked that civilized country to the curb in favor of globalist multiculturalism and that getting attacked by knife weilding Somalians is an affliction they brought onto the British people and now themselves by their own deceitful abuses of power that flouted the wishes of the electorate by opening the immigration flood gates to millions of these uncivilized and violent third world immigrants. Sometimes when they say you reap what you sew... Sometimes that's true.

raven9