No one on that Twitter thread seems to have noticed this patented sequence is part of the same RNA sequence that back in February 2020 the scientists from the University of New Delhi identified as the forth HIV-1 insert in the SARS-CoV-2 Spike Protein Genome. That RNA sequence translated to the protein sequence QTNSPRRA

That 4th Insert sequence aligned over this patented sequence:

CAGACTAATTCTCCTCGGCGGGCA
..........CTCCTCGGCGGGCACGTAG