all 5 comments

[–]AXXA 6 insightful - 3 fun6 insightful - 2 fun7 insightful - 3 fun -  (3 children)

This sure seems to be proof that Covid was engineered.

[–]Tiwaking 2 insightful - 2 fun2 insightful - 1 fun3 insightful - 2 fun -  (2 children)

AXXA 4 insightful - 1 fun - 6 hours ago This sure seems to be proof that Covid was engineered.

Engineered? I wouldnt give the Chinese that much credit. They probably made it by accident when they were copying someone else's research that they stole.

[–]JasonCarswell 2 insightful - 2 fun2 insightful - 1 fun3 insightful - 2 fun -  (0 children)

Now you're not giving Bill Gates and the deep state's Event 201 any credit.

[–]infocom6502 1 insightful - 1 fun1 insightful - 0 fun2 insightful - 1 fun -  (0 children)

The point and whole advantage of a bioweapon over a conventional weapon such as a ballistic missile (which leaves a trajectory whose trace is hard/impossible to fake) is that it used covertly by way of deception. It is much like malware obfuscation + mis-attribution which the elaborate 'Marble' framework was made for --- pinning blame of malware one has designed and deployed on some other country.

It seems pretty clear the Chinese were framed.

Also, another striking feature is that SARS2 seems to be tailored not only to target the elderly (since ACE2 receptors density increases with age), but to target north east europeans, and south asians via the LZTFL1 gene:

This gene is located on chromosome 3, one of the 23 pairs of chromosomes in humans, and is present in around 14% of the Polish population, compared to 8-9% in Europe, and 27% in India.

[....]

The LZTFL1 gene is present in 60% of South Asians [....]

No reason the Chinese would have designed it to target themselves.

[–]raven9 3 insightful - 1 fun3 insightful - 0 fun4 insightful - 1 fun -  (0 children)

No one on that Twitter thread seems to have noticed this patented sequence is part of the same RNA sequence that back in February 2020 the scientists from the University of New Delhi identified as the forth HIV-1 insert in the SARS-CoV-2 Spike Protein Genome. That RNA sequence translated to the protein sequence QTNSPRRA

That 4th Insert sequence aligned over this patented sequence:

CAGACTAATTCTCCTCGGCGGGCA
..........CTCCTCGGCGGGCACGTAG