Deaths among male Teens increased by 53% following Covid-19 Vaccination in 2021 and the Death spikes correlate perfectly with the uptake of dose 1, 2 & 3

IkeConn · 2022-01-18T03:36:42+00:00

Some masterbate. Some get pussy. Old skool virgin masterbator in action.

infocom6502 · 2022-01-18T03:05:11+00:00

Alex Berenson:

What’s this mean? Several things, all bad. We know the vaccines do not stop infection or transmission of the virus (in fact, the report shows elsewhere that vaccinated adults are now being infected at much HIGHER rates than the unvaccinated).

What the British are saying is they are now finding the vaccine interferes with your body’s innate ability after infection to produce antibodies against not just the spike protein but other pieces of the virus. Specifically, vaccinated people don’t seem to be producing antibodies to the nucleocapsid protein, the shell of the virus, which are a crucial part of the response in unvaccinated people.

This means vaccinated people will be far more vulnerable to mutations in the spike protein EVEN AFTER THEY HAVE BEEN INFECTED AND RECOVERED ONCE (or more than once, probably).

It also means the virus is likely to select for mutations that go in exactly that direction, because those will essentially give it an enormous vulnerable population to infect. [emphasis added]

jet199 · 2022-01-17T23:53:05+00:00

Old skool patriarchy theory in action.

IkeConn · 2022-01-17T17:57:19+00:00

The teens that live will have extra pussy available when they grow up.

infocom6502 · 2022-01-17T11:40:00+00:00

“Two years late, you finally realize that a respiratory virus cannot be defeated and that any such attempt is doomed to fail,” he wrote to the Israeli health ministry. “You do not admit it, because you have admitted almost no mistake in the last two years, but in retrospect it is clear that you have failed miserably in almost all of your actions....

“You refused to admit that the infection comes in waves that fade by themselves, despite years of observations and scientific knowledge,” he said. “You refused to admit that recovery is more protective than a vaccine, despite previous knowledge and observations showing that non-recovered vaccinated people are more likely to be infected than recovered people.”

“You refused to admit that the vaccinated are contagious despite the observations. Based on this, you hoped to achieve herd immunity by vaccination — and you failed in that as well.”

infocom6502 · 2022-01-17T10:53:00+00:00

when something isn’t working, what do you do? Sane people would start to listen to qualified people with a different point of view. Insane people keep doing the same stuff over and over again and expect a different result.

In case you haven’t figured it out, we’re in the insanity category. It’s how we roll.

infocom6502 · 2022-01-17T09:13:12+00:00

The big one responsible for the severe respiratory damage that is forcing some to use O2 supplies or get moved to vents seems to be on gene Rs11385942. If you have 23andme, there is a fairly decent proxy (about 99% accurate for caucasians, 80-90% for hispanic) via gene Rs10490770

Note that rs11385942 is not present on the DNA chips used by the major direct-to-consumer genotyping companies such as 23andMe, Ancestry and MyHeritage. In Caucasians, a SNP present on most MyHeritage and Ancestry chips, rs10490770, is a very good proxy for rs11385942 (and it is also present on older versions of the 23andMe chip). The minor allele of rs10490770(C) corresponds most of the time (r2 >0.99 in Caucasians) to the minor rs11385942(A) allele based on data available in ensembl. There is no equivalent linkage in those of African descent; and the correlation is lower in Hispanic populations (r2 ~0.8-0.9).

infocom6502 · 2022-01-17T08:07:11+00:00

The point and whole advantage of a bioweapon over a conventional weapon such as a ballistic missile (which leaves a trajectory whose trace is hard/impossible to fake) is that it used covertly by way of deception. It is much like malware obfuscation + mis-attribution which the elaborate 'Marble' framework was made for --- pinning blame of malware one has designed and deployed on some other country.

It seems pretty clear the Chinese were framed.

Also, another striking feature is that SARS2 seems to be tailored not only to target the elderly (since ACE2 receptors density increases with age), but to target north east europeans, and south asians via the LZTFL1 gene:

This gene is located on chromosome 3, one of the 23 pairs of chromosomes in humans, and is present in around 14% of the Polish population, compared to 8-9% in Europe, and 27% in India.

[....]

The LZTFL1 gene is present in 60% of South Asians [....]

No reason the Chinese would have designed it to target themselves.

FlippyKing · 2022-01-17T00:37:05+00:00

that first British video though, wow. That woman has sold her soul. She's never heard of the the adverse reaction website, and she is correcting Pfizer's ceo's quote because she wanted him to specifically say "for omicron" and steps all over Afroman when he's talking. I didn't bother with the next ones. Iknow the jab is bs, ivermectin and like every anti-inflammatory and anti-oxidant nutrient makes mince meat out of these cold and flu symptoms, and I'm good.

jet199 · 2022-01-17T00:00:24+00:00

So what, much of medicine going forwards is going to be run by the same clique with the same biased results. This isn't just going to be a problem with covid. We're going to have many more illnesses and treatments not properly investigated over the next few years if they don't turn this culture around.

IkeConn · 2022-01-16T18:04:06+00:00

So what, is he a witch and are they going to try to burn him?

raven9 · 2022-01-16T02:10:54+00:00

No one on that Twitter thread seems to have noticed this patented sequence is part of the same RNA sequence that back in February 2020 the scientists from the University of New Delhi identified as the forth HIV-1 insert in the SARS-CoV-2 Spike Protein Genome. That RNA sequence translated to the protein sequence QTNSPRRA

That 4th Insert sequence aligned over this patented sequence:

CAGACTAATTCTCCTCGGCGGGCA
..........CTCCTCGGCGGGCACGTAG

Drewski · 2022-01-16T00:24:38+00:00

Berenson is good on lockdowns, just because he is skeptical of Ivermectin doesn't discredit all the other work he's done. No one is going to get everything right.

JasonCarswell · 2022-01-15T14:51:32+00:00

Now you're not giving Bill Gates and the deep state's Event 201 any credit.

Tiwaking · 2022-01-15T07:56:58+00:00

AXXA 4 insightful - 1 fun - 6 hours ago This sure seems to be proof that Covid was engineered.

Engineered? I wouldnt give the Chinese that much credit. They probably made it by accident when they were copying someone else's research that they stole.

AXXA · 2022-01-15T01:15:41+00:00

This sure seems to be proof that Covid was engineered.

Airbus320 · 2022-01-14T18:22:28+00:00

😮

cisheteroscum · 2022-01-14T13:34:19+00:00

Is that the eternal coomer front and center?

JasonCarswell · 2022-01-14T06:47:17+00:00

I've been in cuddle puddles, with and without clothes, at Burning Man and beyond, but never with children.

Zapped · 2022-01-14T03:01:17+00:00

Come on, man. Now we'll never know what the "rules" are.

Vulptex · 2022-01-14T00:21:49+00:00

I and almost everyone I know caught it between December 2019 and February 2020. I had it again this year, different variant but definitely the same thing overall, and most people who caught it a second time agree.

jet199 · 2022-01-14T00:04:00+00:00

"When your kid gets raped it's on you"

Paraphrased slightly

JasonCarswell · 2022-01-13T23:47:26+00:00

@ 9m+ "International interests" is shifting the blame to the commies instead of the Zionists - proving that despite being generally good, Viva Frei is still a limited hangout and possibly Zionist controlled opposition, intentionally or not.

dissidentrhetoric · 2022-01-13T22:27:12+00:00

Arrest this man

IkeConn · 2022-01-13T20:57:33+00:00

Fire Fauci.

IkeConn · 2022-01-13T20:48:16+00:00

Fire Fauci. That should be a bumper sticker.

IkeConn · 2022-01-13T20:36:33+00:00

Fire Fauci.

raven9 · 2022-01-13T17:03:37+00:00

I have believed all along it all began on June 30, 2019 with an outbreak of a respiratory disease that hospitalised 23 people and killed 3 of them. They were all from the Greenspring assisted living center in Fairfax County Virginia which is 45 minutes away from the level 4 bioweapons labs across the state line at Ft Detrick, Maryland.

At the same time as that outbreak at Greenspring was being investigated, on July 15, the CDC issued a cease and desist order to shut down those bio-labs at Ft. Detrick. It was later admitted there had been breaches of containment (of course they claimed there was no threat to the public).

On July 17, two days after those labs were shut down, Fairfax County announced the CDC had analysed 17 samples from those hospitalized patients but claimed they could not identify a pathogen.

On July 29, Fairfax County released an update that said, "Results of earlier testing submitted to the Centers for Disease Control and Prevention indicated rhinovirus, a virus that causes the common cold."

So we are to believe, for all those weeks, all the resources of the CDC were unable to identify the common cold rhinovirus? LoL.

I think it is more than obvious what really happened. Then about 3 weeks later in August they announced stage 2 of the cover-up. Vaping Illness.

Popper · 2022-01-13T16:14:32+00:00

I think that's caused by genetics but I'm not sure, it might, having a virus constantly attacking the brain for years can't help

jet199 · 2022-01-13T16:01:10+00:00

Isn't Epstein Barr also the virus which can trigger schizophrenia?

Zapped · 2022-01-13T14:29:00+00:00

I know of two people in my area, one that was far away from the first major hubs, who were confirmed to have it in December of 2019: sick in December and positive for antibodies by March of 2020. Talk amongst the medical professionals here is that they suspect it was here in the Fall of 2019.

Popper · 2022-01-13T14:13:49+00:00

it's interesting it says it tires people out, that's not really a scientific term. It likely means it triggers epstein barr causing long haul covid just like covid itself does. That's chronic fatigue.

Tom_Bombadil · 2022-01-13T12:55:20+00:00

If you don't want no shots,get-the-fuck out the club! -Lil John

dissidentrhetoric · 2022-01-13T12:54:26+00:00

omnicon also known as mRNA side effects

1000wombats · 2022-01-13T07:44:28+00:00

Shot after shot after shot, take your soma.

FlippyKing · 2022-01-12T21:22:43+00:00

So the solution would be endless booster shots. One when you wake, one when getting on the subway to go to work, one when crossing into the next borough, one getting off the subway, one walking out on to the street, one entering the building your job is in, one for each side of the elevator, one at the reception desk of the office, one at the cubicle, one at the water cooler, one at the bathroom door, one on the way out along with hand sanitizer after you wash your hands, repeat all on the way to lunch and back to work and again going home, one before dinner, one for dessert, a bed time booster and you're protected from covid by having slightly less sever symptoms and a slightly less chance of spreading it, even if those number are probably fishy as a koi pond in hell, in spite of not having a God-given immune system. What's the problem?

usehername · 2022-01-11T06:14:14+00:00

Archive.

Tiwaking · 2022-01-11T06:07:44+00:00

It's 90% effective folks!! Thats right, 90%!

Tiwaking · 2022-01-11T01:30:44+00:00

16 million tested, 2 cases of DeltaCron found

IkeConn · 2022-01-11T00:44:52+00:00

It's only a matter of time until a "woke" news outlet jumps on Covid and exposes big pharma, the FDA, and Fauci. They'll do it just to prop up their ratings.

auch999 · 2022-01-10T23:11:42+00:00

we can not even tell if they died "With COVID". Or just with a positive test.

^

Caliban · 2022-01-10T20:47:48+00:00

That's because he's brought to you by Pfizer.. just like your corporate news.

raven9 · 2022-01-10T19:48:05+00:00

He can he just doesnt want to. Every year a similar number of people die. The number of deaths over and above that number died of something new.

FlippyKing · 2022-01-10T19:27:25+00:00

It will never end till we end it or, paraphrasing someone else, when we stop playing pandemic

AmericanMuskrat · 2022-01-10T15:14:36+00:00

Exactly! They're creating this problem for a vaccine that doesn't work!

On the plus side, for the wife, the salaries and retention bonuses for vaccinated healthcare workers are awesome right now because of the shortage.

zyxzevn · 2022-01-10T15:04:02+00:00

With a test that gives 95% to 99% false positives, we can not even tell if they died "With COVID".
Or just with a positive test.

An interesting question would be: How many have died by wrong medical treatments?
With pushing life-killing treatments: remdesivir, ventilators, isolation, ignored treatments. infections in hospitals.
And blocking life-saving treatments: Early treatments(HCQ+Zinc, Ivermectin, Vit-D, Vit-C, etc), Sun, Fitness, Social contract

AmericanMuskrat · 2022-01-10T15:03:41+00:00

Because of the vaccine mandates.

It's backwards. Fire people who won't take the vaccine that doesn't work, let people who are infected and can spread covid work.

Tiwaking · 2022-01-10T06:04:53+00:00

Its as tall as a millionaires row skyscraper or their municipal tax rate

socks · 2022-01-10T00:05:30+00:00

Hospitals can no longer cope with the spread of the virus by people who don't want to follow the usual guidelines.

jamesK_3rd · 2022-01-09T23:15:12+00:00

Just had a new variant come out. I'd say things are only really getting started.

IkeConn · 2022-01-09T19:28:18+00:00

Lots of fat kids out there. Their mommas take them to McDonald's instead of cooking healthy.

IkeConn · 2022-01-09T17:40:35+00:00

Too bad they fired all those employees that refused the vaccine of death and all those vaccinated remaining employees are sick with Covid. Just too fucking bad.

IkeConn · 2022-01-09T17:40:03+00:00

Too bad they fired all those employees that refused the vaccine of death and all those vaccinated remaining employees are sick with Covid. Just too fucking bad.

FlippyKing · 2022-01-09T17:29:42+00:00

someday everyone will admit out loud that cases are meaningless and the tests are useless. The sooner the better.

AmericanMuskrat · 2022-01-08T05:48:25+00:00

It's brutal. I'm staying in though, see how it goes. This stuff has been cyclical so far.

d3rr · 2022-01-08T04:35:30+00:00

I bet there's like a 50% chance that there will be no booster mandate in a month. Maybe it's a good time to be catching omnicon.

d3rr · 2022-01-08T04:34:10+00:00

whooeewee down 15% in a week. i cashed everything out like a month ago, I might have finally done something right. It looks like we'll be finding the bottom in the next couple of weeks.

AmericanMuskrat · 2022-01-08T04:27:52+00:00

Also now I hope you had talked your sis out of eth. Fucking ouch!

Tom_Bombadil · 2022-01-08T04:15:23+00:00

These same scumbags were forecasting the contract tracing app would save the day.

"Save the day" translates to monitor your every move, and frighten you back into your hermitage, cause you drove by someone with a cold.

AmericanMuskrat · 2022-01-08T02:35:24+00:00

Yep, but more people need to get the memo. Wife has to get the booster now for work unfortunately.

d3rr · 2022-01-08T01:47:34+00:00

No combinations of vaccines or viruses can confer invulnerability to future tussles with SARS-CoV-2.

Post-vaccination infections might, in theory, influence immunity in ways our vaccines can’t.

By rousing immune cells that haven’t responded to previous variants, an Omicron infection could effectively “broaden your immune response,” Rishi Goel, an immunologist at the University of Pennsylvania, told me.

Even in the most optimistic scenario, in which a post-vaccination infection does really turbocharge a vaccinated person’s immune responses, the durability of the most primo effects is still a wild card.

The narrative, she's a crumbling.

IkeConn · 2022-01-08T00:57:06+00:00

Politicians all over the world seem to be forgetting that people remember the shit they do when election day rolls around. November 2022 and 2024 are both going to be a lot of fun in the USA.

jet199 · 2022-01-05T13:14:39+00:00

I think saying it's mass psychosis is ignoring the fact most people truly believe wrong and even really dumb things all the time. It's just now they've all aligned on one issue.

A bunch of healthy 30 year old teachers believing they are all going to drop dead of covid is really no different to a church full of people believing Christ is going to come back at any minute.

It's a really normal reaction to think these people can't really believe this stuff and there must either be something wrong with them or they are lying but actually it is a constant pattern in human behaviour.

AXXA · 2022-01-05T11:50:54+00:00

Mass formation occurs when mass isolation and loneliness exist. The solution to mass formation is to reach out to and love those suffering from it.

infocom6502 · 2022-01-05T08:20:05+00:00

a very good interview was linked in the comments:

https://www.youtube.com/watch?v=CRo-ieBEw-8

AXXA · 2022-01-04T16:13:05+00:00

zyxzevn · 2022-01-04T15:18:26+00:00

Ready to be slaughtered?

Popper · 2022-01-04T13:46:24+00:00

sevrely is one thing but even being regular obese is terrible

infocom6502 · 2022-01-04T07:55:18+00:00

I prefer Kovid clowns. but i guess sheep will do.

jet199 · 2022-01-03T23:00:28+00:00

Apparently only 18% of Americans are severely obese and that would be less for kids.

Popper · 2022-01-03T21:53:17+00:00

true, I mean the 61% seems a low percentage, but out of a low sample size anyway. Really people dying of it are all either old or fat, usually both.

jet199 · 2022-01-03T21:52:12+00:00

900 out of millions is still quite low.

Popper · 2022-01-03T21:25:59+00:00

surprised it's that low, tho cdc probably just made it all up, I doubt any teens really needed to be hospitalized. Maybe they went cuz they had a panic attack cuz of the media overhyping it, but turned out to be fine.

infocom6502 · 2022-01-03T07:26:29+00:00

credits for link goes to u\wsc981

IkeConn · 2022-01-02T22:43:30+00:00

People pay good money to watch that shit.

persononinternet · 2022-01-01T23:24:37+00:00

Okay well I'm 35 and had a full and fun life up until now, so...

persononinternet · 2022-01-01T23:21:20+00:00

I feel like such an idiot for being credulous and naïve enough to get the vaccine.

persononinternet · 2022-01-01T23:18:04+00:00

Was just looking at the vegan forum on reddit, a thread about many vegans being anti-vaxx, and was very disheartened to see so many dozens of comments (presumably advocating wariness of the vaccine) deleted, while all the pro-vaccine comments were left up. So many are so fully entrenched in believing that the vaccine cannot be faulted.

AXXA · 2022-01-01T13:49:08+00:00

https://rumble.com/vqx3kb-the-pfizer-inoculations-do-more-harm-than-good.html

AXXA · 2022-01-01T13:48:54+00:00

https://rumble.com/vqx3kb-the-pfizer-inoculations-do-more-harm-than-good.html

AmericanMuskrat · 2021-12-31T18:35:50+00:00

She took up one of only 2 bathrooms for 5 hours, and she used 3 tests in one day apparently. That was mentioned in the CNN article but I'm not linking to them anymore if I can help it.

AXXA · 2021-12-31T02:55:30+00:00

/s/fatpeoplehate

IkeConn · 2021-12-30T23:11:21+00:00

Obestity is a risk factor all by itself.

IkeConn · 2021-12-30T02:32:36+00:00

Translation: we want to spend that money somewhere else.

IkeConn · 2021-12-30T01:17:24+00:00

Is he in prison yet?

JasonCarswell · 2021-12-29T16:57:12+00:00

Plus they become sterilized and/or develop life-long dependencies on big pharma "solutions" - if they survive the eugenics agenda.

Popper · 2021-12-29T14:50:31+00:00

you can tell they knew from the start it's dangerous for kids, or else why was it only for the old at first and still not recommended for young children under 5. This is not how it is for a lot of vaccines which they give to newborn babies. Which cause autism but still at least that is not the same as heart problems.

IkeConn · 2021-12-29T02:21:21+00:00

CNN squashed that story.

IkeConn · 2021-12-29T01:42:59+00:00

This gives me church lady schadenfreude.

doginventer · 2021-12-29T01:39:47+00:00

Robert F Kennedy, Jr. Explains Why They're Going After the Kids -- And It's Not What You Think (VIDEO) https://www.thegatewaypundit.com/2021/12/robert-f-kennedy-jr-explains-going-kids-not-think-video/

The PREP Act provides immunity from liability for the COVID-19 vaccinators. The purpose of the law is to protect Big Pharma.

Robert F. Kennedy recently revealed why Big Pharma and Dr. Fauci are going after the children and babies. Because the vaccines that are recommended for children get liability protection.

Robert F. Kennedy, Jr: “They are never going to market a vaccine, allow people access to a vaccine, an approved vaccine without getting liability protection. Now the emergency use authorization vaccines have liability protection under the PREP Act and under the CARES Act.

So as long as you take an emergency use vaccine, you can’t sue them. Once they get approved, now you can sue them, unless they can get it recommended for children. Because all vaccines that are recommended, officially recommended for children get liability protection, even if an adult gets that vaccine. That’s why they are going after the kids. They know this is going to kill and injure a huge number of children, but they need to do it for the liability protection.”

IkeConn · 2021-12-28T18:52:30+00:00

Those masked servants farted on her family every chance they got.

IkeConn · 2021-12-28T18:12:58+00:00

Are they actively trying to kill us or is it totally profit driven mismanagement?

JasonCarswell · 2021-12-28T14:43:57+00:00

It wouldn't surprise me if they put him on Remdesivir.

Popper · 2021-12-28T13:33:58+00:00

yeah sounds like it wasn't really covid that killed him, or if it was they caused it by illegally keeping him

hennaojichan · 2021-12-28T04:26:14+00:00

Thank you for that.

JasonCarswell · 2021-12-27T22:49:20+00:00

74 yo health problems and co-morbidities. They don't tell me much. I wrote about it last year...
/s/CriticalThoughts/comments/7f6v/dr_david_james_carswell_my_father_died_of_covid/

Popper · 2021-12-27T20:32:01+00:00

why did he go to the hospital in the first place?

JasonCarswell · 2021-12-27T19:53:00+00:00

Last New Years my dad went in the hospital for a week. He came back with COVID and gave it to my mom. They went to 2 different hospitals. He was in a coma for 3 weeks on a ventilator and died, "with COVID". She made it out alive and want's to blame me for pointing out the entire rigged system is bullshit.

Horrux · 2021-12-26T22:51:19+00:00

Christine Anderson

https://truthcomestolight.com/christine-anderson-german-member-of-the-european-parliament-pharmaceutical-companies-are-about-as-interested-in-public-health-as-the-arms-industry-is-in-world-peace/

jet199 · 2021-12-26T20:10:23+00:00

I'm starting to stop feeling sorry for these countries and starting to think back on that old English saying.

People get the politicians they deserve

Because of the vaccine mandates.

Coronavirus

Coronavirus

MODERATORS