Deaths among male Teens increased by 53% following Covid-19 Vaccination in 2021 and the Death spikes correlate perfectly with the uptake of dose 1, 2 & 3 by dissidentrhetoric in Coronavirus

[–]IkeConn 1 insightful - 1 fun1 insightful - 0 fun2 insightful - 1 fun -  (0 children)

Some masterbate. Some get pussy. Old skool virgin masterbator in action.

Known since at least October: EUA vaccines will keep you from acquiring full (optimal) immunity EVEN after infection; impairs Nucleocapsid antibody response, which is often broad response to other Coronaviruses by infocom6502 in Coronavirus

[–]infocom6502[S] 1 insightful - 1 fun1 insightful - 0 fun2 insightful - 1 fun -  (0 children)

Alex Berenson:

What’s this mean? Several things, all bad. We know the vaccines do not stop infection or transmission of the virus (in fact, the report shows elsewhere that vaccinated adults are now being infected at much HIGHER rates than the unvaccinated).

What the British are saying is they are now finding the vaccine interferes with your body’s innate ability after infection to produce antibodies against not just the spike protein but other pieces of the virus. Specifically, vaccinated people don’t seem to be producing antibodies to the nucleocapsid protein, the shell of the virus, which are a crucial part of the response in unvaccinated people.

This means vaccinated people will be far more vulnerable to mutations in the spike protein EVEN AFTER THEY HAVE BEEN INFECTED AND RECOVERED ONCE (or more than once, probably).

It also means the virus is likely to select for mutations that go in exactly that direction, because those will essentially give it an enormous vulnerable population to infect. [emphasis added]

Deaths among male Teens increased by 53% following Covid-19 Vaccination in 2021 and the Death spikes correlate perfectly with the uptake of dose 1, 2 & 3 by dissidentrhetoric in Coronavirus

[–]IkeConn 1 insightful - 2 fun1 insightful - 1 fun2 insightful - 2 fun -  (0 children)

The teens that live will have extra pussy available when they grow up.

There Is Currently No Medical Emergency Only Psychological Engineering Says Senior Israeli Immunologist by infocom6502 in Coronavirus

[–]infocom6502[S] 1 insightful - 1 fun1 insightful - 0 fun2 insightful - 1 fun -  (0 children)

“Two years late, you finally realize that a respiratory virus cannot be defeated and that any such attempt is doomed to fail,” he wrote to the Israeli health ministry. “You do not admit it, because you have admitted almost no mistake in the last two years, but in retrospect it is clear that you have failed miserably in almost all of your actions....

“You refused to admit that the infection comes in waves that fade by themselves, despite years of observations and scientific knowledge,” he said. “You refused to admit that recovery is more protective than a vaccine, despite previous knowledge and observations showing that non-recovered vaccinated people are more likely to be infected than recovered people.”

“You refused to admit that the vaccinated are contagious despite the observations. Based on this, you hoped to achieve herd immunity by vaccination — and you failed in that as well.”

Steve Kirsch's January 2022 briefing on state of the Kovid Clown World by infocom6502 in Coronavirus

[–]infocom6502[S] 1 insightful - 1 fun1 insightful - 0 fun2 insightful - 1 fun -  (0 children)

when something isn’t working, what do you do? Sane people would start to listen to qualified people with a different point of view. Insane people keep doing the same stuff over and over again and expect a different result.

In case you haven’t figured it out, we’re in the insanity category. It’s how we roll.

Genetic risk factors for developing SARS, and geographic distribution of such genes by infocom6502 in Coronavirus

[–]infocom6502[S] 1 insightful - 1 fun1 insightful - 0 fun2 insightful - 1 fun -  (0 children)

The big one responsible for the severe respiratory damage that is forcing some to use O2 supplies or get moved to vents seems to be on gene Rs11385942. If you have 23andme, there is a fairly decent proxy (about 99% accurate for caucasians, 80-90% for hispanic) via gene Rs10490770

Note that rs11385942 is not present on the DNA chips used by the major direct-to-consumer genotyping companies such as 23andMe, Ancestry and MyHeritage. In Caucasians, a SNP present on most MyHeritage and Ancestry chips, rs10490770, is a very good proxy for rs11385942 (and it is also present on older versions of the 23andMe chip). The minor allele of rs10490770(C) corresponds most of the time (r2 >0.99 in Caucasians) to the minor rs11385942(A) allele based on data available in ensembl. There is no equivalent linkage in those of African descent; and the correlation is lower in Hispanic populations (r2 ~0.8-0.9).

#CTCCTCGGCGGGCACGTAG by Questionable in Coronavirus

[–]infocom6502 1 insightful - 1 fun1 insightful - 0 fun2 insightful - 1 fun -  (0 children)

The point and whole advantage of a bioweapon over a conventional weapon such as a ballistic missile (which leaves a trajectory whose trace is hard/impossible to fake) is that it used covertly by way of deception. It is much like malware obfuscation + mis-attribution which the elaborate 'Marble' framework was made for --- pinning blame of malware one has designed and deployed on some other country.

It seems pretty clear the Chinese were framed.

Also, another striking feature is that SARS2 seems to be tailored not only to target the elderly (since ACE2 receptors density increases with age), but to target north east europeans, and south asians via the LZTFL1 gene:

This gene is located on chromosome 3, one of the 23 pairs of chromosomes in humans, and is present in around 14% of the Polish population, compared to 8-9% in Europe, and 27% in India.

[....]

The LZTFL1 gene is present in 60% of South Asians [....]

No reason the Chinese would have designed it to target themselves.

Raising questions about the vaccine by jet199 in Coronavirus

[–]FlippyKing 2 insightful - 1 fun2 insightful - 0 fun3 insightful - 1 fun -  (0 children)

that first British video though, wow. That woman has sold her soul. She's never heard of the the adverse reaction website, and she is correcting Pfizer's ceo's quote because she wanted him to specifically say "for omicron" and steps all over Afroman when he's talking. I didn't bother with the next ones. Iknow the jab is bs, ivermectin and like every anti-inflammatory and anti-oxidant nutrient makes mince meat out of these cold and flu symptoms, and I'm good.

'The death of science' Professor silenced for suggesting Covid could have escaped from lab by jet199 in Coronavirus

[–]jet199[S] 3 insightful - 2 fun3 insightful - 1 fun4 insightful - 2 fun -  (0 children)

So what, much of medicine going forwards is going to be run by the same clique with the same biased results. This isn't just going to be a problem with covid. We're going to have many more illnesses and treatments not properly investigated over the next few years if they don't turn this culture around.

'The death of science' Professor silenced for suggesting Covid could have escaped from lab by jet199 in Coronavirus

[–]IkeConn 3 insightful - 2 fun3 insightful - 1 fun4 insightful - 2 fun -  (0 children)

So what, is he a witch and are they going to try to burn him?

#CTCCTCGGCGGGCACGTAG by Questionable in Coronavirus

[–]raven9 3 insightful - 1 fun3 insightful - 0 fun4 insightful - 1 fun -  (0 children)

No one on that Twitter thread seems to have noticed this patented sequence is part of the same RNA sequence that back in February 2020 the scientists from the University of New Delhi identified as the forth HIV-1 insert in the SARS-CoV-2 Spike Protein Genome. That RNA sequence translated to the protein sequence QTNSPRRA

That 4th Insert sequence aligned over this patented sequence:

CAGACTAATTCTCCTCGGCGGGCA
..........CTCCTCGGCGGGCACGTAG

Why did Alex Berenson Engage in an Unprompted Attack on Robert Malone and Ivermectin? by StillLessons in Coronavirus

[–]Drewski 2 insightful - 1 fun2 insightful - 0 fun3 insightful - 1 fun -  (0 children)

Berenson is good on lockdowns, just because he is skeptical of Ivermectin doesn't discredit all the other work he's done. No one is going to get everything right.

#CTCCTCGGCGGGCACGTAG by Questionable in Coronavirus

[–]JasonCarswell 2 insightful - 2 fun2 insightful - 1 fun3 insightful - 2 fun -  (0 children)

Now you're not giving Bill Gates and the deep state's Event 201 any credit.

#CTCCTCGGCGGGCACGTAG by Questionable in Coronavirus

[–]Tiwaking 2 insightful - 2 fun2 insightful - 1 fun3 insightful - 2 fun -  (0 children)

AXXA 4 insightful - 1 fun - 6 hours ago This sure seems to be proof that Covid was engineered.

Engineered? I wouldnt give the Chinese that much credit. They probably made it by accident when they were copying someone else's research that they stole.

#CTCCTCGGCGGGCACGTAG by Questionable in Coronavirus

[–]AXXA 6 insightful - 3 fun6 insightful - 2 fun7 insightful - 3 fun -  (0 children)

This sure seems to be proof that Covid was engineered.

Some of these people are just fucking weird by P-38lightning in Coronavirus

[–]Airbus320 2 insightful - 2 fun2 insightful - 1 fun3 insightful - 2 fun -  (0 children)

😮

Some of these people are just fucking weird by P-38lightning in Coronavirus

[–]cisheteroscum 4 insightful - 3 fun4 insightful - 2 fun5 insightful - 3 fun -  (0 children)

Is that the eternal coomer front and center?

Some of these people are just fucking weird by P-38lightning in Coronavirus

[–]JasonCarswell 3 insightful - 5 fun3 insightful - 4 fun4 insightful - 5 fun -  (0 children)

I've been in cuddle puddles, with and without clothes, at Burning Man and beyond, but never with children.

Some of these people are just fucking weird by P-38lightning in Coronavirus

[–]Zapped 4 insightful - 4 fun4 insightful - 3 fun5 insightful - 4 fun -  (0 children)

Come on, man. Now we'll never know what the "rules" are.

This Largely Ignored CDC Study Found That SARS-CoV-2 Infection Was Already Widespread in the United States by Mid-December 2019 by raven9 in Coronavirus

[–]Vulptex 2 insightful - 1 fun2 insightful - 0 fun3 insightful - 1 fun -  (0 children)

I and almost everyone I know caught it between December 2019 and February 2020. I had it again this year, different variant but definitely the same thing overall, and most people who caught it a second time agree.

Some of these people are just fucking weird by P-38lightning in Coronavirus

[–]jet199 5 insightful - 4 fun5 insightful - 3 fun6 insightful - 4 fun -  (0 children)

"When your kid gets raped it's on you"

Paraphrased slightly

Fauci & "Top Scientists" LIED TO US about Possible Covid Leak Theories - Viva Frei Vlawg (11:43) ~ Viva Frei by JasonCarswell in Coronavirus

[–]JasonCarswell[S] 1 insightful - 2 fun1 insightful - 1 fun2 insightful - 2 fun -  (0 children)

@ 9m+ "International interests" is shifting the blame to the commies instead of the Zionists - proving that despite being generally good, Viva Frei is still a limited hangout and possibly Zionist controlled opposition, intentionally or not.

Dr. Rand Paul Slams Dr. Fauci for Refusing to Answer Questions at HELP Hearing by dissidentrhetoric in Coronavirus

[–]dissidentrhetoric[S] 3 insightful - 2 fun3 insightful - 1 fun4 insightful - 2 fun -  (0 children)

Arrest this man

House Republicans release damning Fauci emails suggesting concealed knowledge of lab leak by AXXA in Coronavirus

[–]IkeConn 1 insightful - 1 fun1 insightful - 0 fun2 insightful - 1 fun -  (0 children)

Fire Fauci.

Video: Fauci Yearned For A Pandemic Before COVID Hit (3:03) ~ The Jimmy Dore Show by JasonCarswell in Coronavirus

[–]IkeConn 2 insightful - 2 fun2 insightful - 1 fun3 insightful - 2 fun -  (0 children)

Fire Fauci. That should be a bumper sticker.

Dr. Rand Paul Slams Dr. Fauci for Refusing to Answer Questions at HELP Hearing by dissidentrhetoric in Coronavirus

[–]IkeConn 1 insightful - 1 fun1 insightful - 0 fun2 insightful - 1 fun -  (0 children)

Fire Fauci.

This Largely Ignored CDC Study Found That SARS-CoV-2 Infection Was Already Widespread in the United States by Mid-December 2019 by raven9 in Coronavirus

[–]raven9[S] 3 insightful - 1 fun3 insightful - 0 fun4 insightful - 1 fun -  (0 children)

I have believed all along it all began on June 30, 2019 with an outbreak of a respiratory disease that hospitalised 23 people and killed 3 of them. They were all from the Greenspring assisted living center in Fairfax County Virginia which is 45 minutes away from the level 4 bioweapons labs across the state line at Ft Detrick, Maryland.

At the same time as that outbreak at Greenspring was being investigated, on July 15, the CDC issued a cease and desist order to shut down those bio-labs at Ft. Detrick. It was later admitted there had been breaches of containment (of course they claimed there was no threat to the public).

On July 17, two days after those labs were shut down, Fairfax County announced the CDC had analysed 17 samples from those hospitalized patients but claimed they could not identify a pathogen.

On July 29, Fairfax County released an update that said, "Results of earlier testing submitted to the Centers for Disease Control and Prevention indicated rhinovirus, a virus that causes the common cold."

So we are to believe, for all those weeks, all the resources of the CDC were unable to identify the common cold rhinovirus? LoL.

I think it is more than obvious what really happened. Then about 3 weeks later in August they announced stage 2 of the cover-up. Vaping Illness.

EU Warns Repeat Boosters Could Weaken Immune System by jet199 in Coronavirus

[–]Popper 1 insightful - 1 fun1 insightful - 0 fun2 insightful - 1 fun -  (0 children)

I think that's caused by genetics but I'm not sure, it might, having a virus constantly attacking the brain for years can't help

EU Warns Repeat Boosters Could Weaken Immune System by jet199 in Coronavirus

[–]jet199[S] 1 insightful - 1 fun1 insightful - 0 fun2 insightful - 1 fun -  (0 children)

Isn't Epstein Barr also the virus which can trigger schizophrenia?

This Largely Ignored CDC Study Found That SARS-CoV-2 Infection Was Already Widespread in the United States by Mid-December 2019 by raven9 in Coronavirus

[–]Zapped 4 insightful - 1 fun4 insightful - 0 fun5 insightful - 1 fun -  (0 children)

I know of two people in my area, one that was far away from the first major hubs, who were confirmed to have it in December of 2019: sick in December and positive for antibodies by March of 2020. Talk amongst the medical professionals here is that they suspect it was here in the Fall of 2019.

EU Warns Repeat Boosters Could Weaken Immune System by jet199 in Coronavirus

[–]Popper 2 insightful - 1 fun2 insightful - 0 fun3 insightful - 1 fun -  (0 children)

it's interesting it says it tires people out, that's not really a scientific term. It likely means it triggers epstein barr causing long haul covid just like covid itself does. That's chronic fatigue.

EU Warns Repeat Boosters Could Weaken Immune System by jet199 in Coronavirus

[–]Tom_Bombadil 2 insightful - 1 fun2 insightful - 0 fun3 insightful - 1 fun -  (0 children)

If you don't want no shots,get-the-fuck out the club! -Lil John

Congratulations New York. You flattened the curve. by P-38lightning in Coronavirus

[–]dissidentrhetoric 2 insightful - 1 fun2 insightful - 0 fun3 insightful - 1 fun -  (0 children)

omnicon also known as mRNA side effects

EU Warns Repeat Boosters Could Weaken Immune System by jet199 in Coronavirus

[–]1000wombats 2 insightful - 1 fun2 insightful - 0 fun3 insightful - 1 fun -  (0 children)

Shot after shot after shot, take your soma.

EU Warns Repeat Boosters Could Weaken Immune System by jet199 in Coronavirus

[–]FlippyKing 2 insightful - 2 fun2 insightful - 1 fun3 insightful - 2 fun -  (0 children)

So the solution would be endless booster shots. One when you wake, one when getting on the subway to go to work, one when crossing into the next borough, one getting off the subway, one walking out on to the street, one entering the building your job is in, one for each side of the elevator, one at the reception desk of the office, one at the cubicle, one at the water cooler, one at the bathroom door, one on the way out along with hand sanitizer after you wash your hands, repeat all on the way to lunch and back to work and again going home, one before dinner, one for dessert, a bed time booster and you're protected from covid by having slightly less sever symptoms and a slightly less chance of spreading it, even if those number are probably fishy as a koi pond in hell, in spite of not having a God-given immune system. What's the problem?

They Can't Keep Getting Away With It... by Tiwaking in Coronavirus

[–]Tiwaking[S] 2 insightful - 1 fun2 insightful - 0 fun3 insightful - 1 fun -  (0 children)

It's 90% effective folks!! Thats right, 90%!

Gravitas: Amid Omicron surge, Deltacron discovered in Cyprus by Tiwaking in Coronavirus

[–]Tiwaking[S] 2 insightful - 1 fun2 insightful - 0 fun3 insightful - 1 fun -  (0 children)

16 million tested, 2 cases of DeltaCron found

CNN, Tapper Finally Discover 'Misleading' COVID Hospitalization Numbers by jet199 in Coronavirus

[–]IkeConn 3 insightful - 2 fun3 insightful - 1 fun4 insightful - 2 fun -  (0 children)

It's only a matter of time until a "woke" news outlet jumps on Covid and exposes big pharma, the FDA, and Fauci. They'll do it just to prop up their ratings.

CDC Director Can’t Say How Many Of 836,000 Deaths Are ‘From COVID’ And How Many Are ‘With COVID’ by jet199 in Coronavirus

[–]auch999 1 insightful - 1 fun1 insightful - 0 fun2 insightful - 1 fun -  (0 children)

we can not even tell if they died "With COVID". Or just with a positive test.

^

CDC Director Can’t Say How Many Of 836,000 Deaths Are ‘From COVID’ And How Many Are ‘With COVID’ by jet199 in Coronavirus

[–]Caliban 3 insightful - 1 fun3 insightful - 0 fun4 insightful - 1 fun -  (0 children)

That's because he's brought to you by Pfizer.. just like your corporate news.

CDC Director Can’t Say How Many Of 836,000 Deaths Are ‘From COVID’ And How Many Are ‘With COVID’ by jet199 in Coronavirus

[–]raven9 2 insightful - 1 fun2 insightful - 0 fun3 insightful - 1 fun -  (0 children)

He can he just doesnt want to. Every year a similar number of people die. The number of deaths over and above that number died of something new.

Congratulations New York. You flattened the curve. by P-38lightning in Coronavirus

[–]FlippyKing 1 insightful - 1 fun1 insightful - 0 fun2 insightful - 1 fun -  (0 children)

It will never end till we end it or, paraphrasing someone else, when we stop playing pandemic

California went from mandating vaccines to forcing COVID-positive health care employees to work by AmericanMuskrat in Coronavirus

[–]AmericanMuskrat[S] 3 insightful - 2 fun3 insightful - 1 fun4 insightful - 2 fun -  (0 children)

Exactly! They're creating this problem for a vaccine that doesn't work!

On the plus side, for the wife, the salaries and retention bonuses for vaccinated healthcare workers are awesome right now because of the shortage.

CDC Director Can’t Say How Many Of 836,000 Deaths Are ‘From COVID’ And How Many Are ‘With COVID’ by jet199 in Coronavirus

[–]zyxzevn 4 insightful - 2 fun4 insightful - 1 fun5 insightful - 2 fun -  (0 children)

With a test that gives 95% to 99% false positives, we can not even tell if they died "With COVID".
Or just with a positive test.

An interesting question would be: How many have died by wrong medical treatments?
With pushing life-killing treatments: remdesivir, ventilators, isolation, ignored treatments. infections in hospitals.
And blocking life-saving treatments: Early treatments(HCQ+Zinc, Ivermectin, Vit-D, Vit-C, etc), Sun, Fitness, Social contract

Arizona hospital's 'staffing crisis' means COVID-positive, symptomatic employees permitted to work by AmericanMuskrat in Coronavirus

[–]AmericanMuskrat[S] 2 insightful - 1 fun2 insightful - 0 fun3 insightful - 1 fun -  (0 children)

Because of the vaccine mandates.

It's backwards. Fire people who won't take the vaccine that doesn't work, let people who are infected and can spread covid work.

Congratulations New York. You flattened the curve. by P-38lightning in Coronavirus

[–]Tiwaking 2 insightful - 1 fun2 insightful - 0 fun3 insightful - 1 fun -  (0 children)

Its as tall as a millionaires row skyscraper or their municipal tax rate

Arizona hospital's 'staffing crisis' means COVID-positive, symptomatic employees permitted to work by AmericanMuskrat in Coronavirus

[–]socks 1 insightful - 1 fun1 insightful - 0 fun2 insightful - 1 fun -  (0 children)

Hospitals can no longer cope with the spread of the virus by people who don't want to follow the usual guidelines.

Congratulations New York. You flattened the curve. by P-38lightning in Coronavirus

[–]jamesK_3rd 3 insightful - 2 fun3 insightful - 1 fun4 insightful - 2 fun -  (0 children)

Just had a new variant come out. I'd say things are only really getting started.

CDC: 61% of Teenagers Hospitalized for COVID-19 Had Severe Obesity by jet199 in Coronavirus

[–]IkeConn 1 insightful - 1 fun1 insightful - 0 fun2 insightful - 1 fun -  (0 children)

Lots of fat kids out there. Their mommas take them to McDonald's instead of cooking healthy.

California went from mandating vaccines to forcing COVID-positive health care employees to work by AmericanMuskrat in Coronavirus

[–]IkeConn 3 insightful - 2 fun3 insightful - 1 fun4 insightful - 2 fun -  (0 children)

Too bad they fired all those employees that refused the vaccine of death and all those vaccinated remaining employees are sick with Covid. Just too fucking bad.

Arizona hospital's 'staffing crisis' means COVID-positive, symptomatic employees permitted to work by AmericanMuskrat in Coronavirus

[–]IkeConn 3 insightful - 2 fun3 insightful - 1 fun4 insightful - 2 fun -  (0 children)

Too bad they fired all those employees that refused the vaccine of death and all those vaccinated remaining employees are sick with Covid. Just too fucking bad.

Congratulations New York. You flattened the curve. by P-38lightning in Coronavirus

[–]FlippyKing 4 insightful - 2 fun4 insightful - 1 fun5 insightful - 2 fun -  (0 children)

someday everyone will admit out loud that cases are meaningless and the tests are useless. The sooner the better.

Should I Just Get Omicron Over With? by AmericanMuskrat in Coronavirus

[–]AmericanMuskrat[S] 3 insightful - 2 fun3 insightful - 1 fun4 insightful - 2 fun -  (0 children)

It's brutal. I'm staying in though, see how it goes. This stuff has been cyclical so far.

Should I Just Get Omicron Over With? by AmericanMuskrat in Coronavirus

[–]d3rr 3 insightful - 3 fun3 insightful - 2 fun4 insightful - 3 fun -  (0 children)

I bet there's like a 50% chance that there will be no booster mandate in a month. Maybe it's a good time to be catching omnicon.

Should I Just Get Omicron Over With? by AmericanMuskrat in Coronavirus

[–]d3rr 2 insightful - 2 fun2 insightful - 1 fun3 insightful - 2 fun -  (0 children)

whooeewee down 15% in a week. i cashed everything out like a month ago, I might have finally done something right. It looks like we'll be finding the bottom in the next couple of weeks.

Should I Just Get Omicron Over With? by AmericanMuskrat in Coronavirus

[–]AmericanMuskrat[S] 3 insightful - 2 fun3 insightful - 1 fun4 insightful - 2 fun -  (0 children)

Also now I hope you had talked your sis out of eth. Fucking ouch!

Should I Just Get Omicron Over With? by AmericanMuskrat in Coronavirus

[–]Tom_Bombadil 3 insightful - 3 fun3 insightful - 2 fun4 insightful - 3 fun -  (0 children)

These same scumbags were forecasting the contract tracing app would save the day.

"Save the day" translates to monitor your every move, and frighten you back into your hermitage, cause you drove by someone with a cold.

Should I Just Get Omicron Over With? by AmericanMuskrat in Coronavirus

[–]AmericanMuskrat[S] 2 insightful - 2 fun2 insightful - 1 fun3 insightful - 2 fun -  (0 children)

Yep, but more people need to get the memo. Wife has to get the booster now for work unfortunately.

Should I Just Get Omicron Over With? by AmericanMuskrat in Coronavirus

[–]d3rr 5 insightful - 3 fun5 insightful - 2 fun6 insightful - 3 fun -  (0 children)

No combinations of vaccines or viruses can confer invulnerability to future tussles with SARS-CoV-2.

Post-vaccination infections might, in theory, influence immunity in ways our vaccines can’t.

By rousing immune cells that haven’t responded to previous variants, an Omicron infection could effectively “broaden your immune response,” Rishi Goel, an immunologist at the University of Pennsylvania, told me.

Even in the most optimistic scenario, in which a post-vaccination infection does really turbocharge a vaccinated person’s immune responses, the durability of the most primo effects is still a wild card.

The narrative, she's a crumbling.

Australia's Northern Territory has imposed a China-like lockdown of all unvaccinated citizens by AXXA in Coronavirus

[–]IkeConn 2 insightful - 2 fun2 insightful - 1 fun3 insightful - 2 fun -  (0 children)

Politicians all over the world seem to be forgetting that people remember the shit they do when election day rolls around. November 2022 and 2024 are both going to be a lot of fun in the USA.

Opinion: How have we gotten here? Mass Formation Psychosis, explained by infocom6502 in Coronavirus

[–]jet199 2 insightful - 1 fun2 insightful - 0 fun3 insightful - 1 fun -  (0 children)

I think saying it's mass psychosis is ignoring the fact most people truly believe wrong and even really dumb things all the time. It's just now they've all aligned on one issue.

A bunch of healthy 30 year old teachers believing they are all going to drop dead of covid is really no different to a church full of people believing Christ is going to come back at any minute.

It's a really normal reaction to think these people can't really believe this stuff and there must either be something wrong with them or they are lying but actually it is a constant pattern in human behaviour.

Opinion: How have we gotten here? Mass Formation Psychosis, explained by infocom6502 in Coronavirus

[–]AXXA 3 insightful - 2 fun3 insightful - 1 fun4 insightful - 2 fun -  (0 children)

Mass formation occurs when mass isolation and loneliness exist. The solution to mass formation is to reach out to and love those suffering from it.

Opinion: How have we gotten here? Mass Formation Psychosis, explained by infocom6502 in Coronavirus

[–]infocom6502[S] 2 insightful - 1 fun2 insightful - 0 fun3 insightful - 1 fun -  (0 children)

a very good interview was linked in the comments:

https://www.youtube.com/watch?v=CRo-ieBEw-8

700 sheep and goats were arranged in the shape of a syringe to encourage vaccinations (Germany) by infocom6502 in Coronavirus

[–]AXXA 3 insightful - 1 fun3 insightful - 0 fun4 insightful - 1 fun -  (0 children)

baa

700 sheep and goats were arranged in the shape of a syringe to encourage vaccinations (Germany) by infocom6502 in Coronavirus

[–]zyxzevn 3 insightful - 2 fun3 insightful - 1 fun4 insightful - 2 fun -  (0 children)

Ready to be slaughtered?

CDC: 61% of Teenagers Hospitalized for COVID-19 Had Severe Obesity by jet199 in Coronavirus

[–]Popper 1 insightful - 1 fun1 insightful - 0 fun2 insightful - 1 fun -  (0 children)

sevrely is one thing but even being regular obese is terrible

700 sheep and goats were arranged in the shape of a syringe to encourage vaccinations (Germany) by infocom6502 in Coronavirus

[–]infocom6502[S] 2 insightful - 1 fun2 insightful - 0 fun3 insightful - 1 fun -  (0 children)

I prefer Kovid clowns. but i guess sheep will do.

CDC: 61% of Teenagers Hospitalized for COVID-19 Had Severe Obesity by jet199 in Coronavirus

[–]jet199[S] 5 insightful - 3 fun5 insightful - 2 fun6 insightful - 3 fun -  (0 children)

Apparently only 18% of Americans are severely obese and that would be less for kids.

CDC: 61% of Teenagers Hospitalized for COVID-19 Had Severe Obesity by jet199 in Coronavirus

[–]Popper 2 insightful - 1 fun2 insightful - 0 fun3 insightful - 1 fun -  (0 children)

true, I mean the 61% seems a low percentage, but out of a low sample size anyway. Really people dying of it are all either old or fat, usually both.

CDC: 61% of Teenagers Hospitalized for COVID-19 Had Severe Obesity by jet199 in Coronavirus

[–]jet199[S] 3 insightful - 3 fun3 insightful - 2 fun4 insightful - 3 fun -  (0 children)

900 out of millions is still quite low.

CDC: 61% of Teenagers Hospitalized for COVID-19 Had Severe Obesity by jet199 in Coronavirus

[–]Popper 2 insightful - 2 fun2 insightful - 1 fun3 insightful - 2 fun -  (0 children)

surprised it's that low, tho cdc probably just made it all up, I doubt any teens really needed to be hospitalized. Maybe they went cuz they had a panic attack cuz of the media overhyping it, but turned out to be fine.

German health data suggests vaccination increases odds of Omicron infection (infection rates far higher among the vaxinated) by infocom6502 in Coronavirus

[–]infocom6502[S] 1 insightful - 1 fun1 insightful - 0 fun2 insightful - 1 fun -  (0 children)

credits for link goes to u\wsc981

CNN Caught Lying About Omicron Deaths (15:59) ~ The Jimmy Dore Show by JasonCarswell in Coronavirus

[–]IkeConn 2 insightful - 2 fun2 insightful - 1 fun3 insightful - 2 fun -  (0 children)

People pay good money to watch that shit.

Here’s Why Most of the Jabbed Will Die Early - Dr Vernon Coleman. by doginventer in Coronavirus

[–]persononinternet 3 insightful - 2 fun3 insightful - 1 fun4 insightful - 2 fun -  (0 children)

Okay well I'm 35 and had a full and fun life up until now, so...

Canadian COVID Care Alliance explains why Pfizer shots can do more harm than good by AXXA in Coronavirus

[–]persononinternet 3 insightful - 2 fun3 insightful - 1 fun4 insightful - 2 fun -  (0 children)

I feel like such an idiot for being credulous and naïve enough to get the vaccine.

Pandemic of the vaccinated: Two studies show new evidence that Covid-19 vaccines cause more illness than they prevent by AXXA in Coronavirus

[–]persononinternet 2 insightful - 2 fun2 insightful - 1 fun3 insightful - 2 fun -  (0 children)

Was just looking at the vegan forum on reddit, a thread about many vegans being anti-vaxx, and was very disheartened to see so many dozens of comments (presumably advocating wariness of the vaccine) deleted, while all the pro-vaccine comments were left up. So many are so fully entrenched in believing that the vaccine cannot be faulted.

Woman tests positive for COVID-19 on flight, isolates for 5 hours in bathroom by AmericanMuskrat in Coronavirus

[–]AmericanMuskrat[S] 2 insightful - 1 fun2 insightful - 0 fun3 insightful - 1 fun -  (0 children)

She took up one of only 2 bathrooms for 5 hours, and she used 3 tests in one day apparently. That was mentioned in the CNN article but I'm not linking to them anymore if I can help it.

Pandemic of the obese: Obesity is a major risk factor for COVID-19 by AXXA in Coronavirus

[–]AXXA[S] 2 insightful - 2 fun2 insightful - 1 fun3 insightful - 2 fun -  (0 children)

Pandemic of the obese: Obesity is a major risk factor for COVID-19 by AXXA in Coronavirus

[–]IkeConn 1 insightful - 1 fun1 insightful - 0 fun2 insightful - 1 fun -  (0 children)

Obestity is a risk factor all by itself.

CDC drops post-isolation PCR test because they can remain positive up to 12 weeks by AXXA in Coronavirus

[–]IkeConn 1 insightful - 1 fun1 insightful - 0 fun2 insightful - 1 fun -  (0 children)

Translation: we want to spend that money somewhere else.

"I shouldn't be giving these vaccines to people" a rare Pharmacist without a God Conplex by Jesus in Coronavirus

[–]IkeConn 1 insightful - 1 fun1 insightful - 0 fun2 insightful - 1 fun -  (0 children)

Is he in prison yet?

Robert F Kennedy, Jr. Explains Why They're Going After the Kids -- And It's Not What You Think (VIDEO) by doginventer in Coronavirus

[–]JasonCarswell 2 insightful - 2 fun2 insightful - 1 fun3 insightful - 2 fun -  (0 children)

Plus they become sterilized and/or develop life-long dependencies on big pharma "solutions" - if they survive the eugenics agenda.

Robert F Kennedy, Jr. Explains Why They're Going After the Kids -- And It's Not What You Think (VIDEO) by doginventer in Coronavirus

[–]Popper 3 insightful - 2 fun3 insightful - 1 fun4 insightful - 2 fun -  (0 children)

you can tell they knew from the start it's dangerous for kids, or else why was it only for the old at first and still not recommended for young children under 5. This is not how it is for a lot of vaccines which they give to newborn babies. Which cause autism but still at least that is not the same as heart problems.

Ivermectin obliterates 97 percent of Delhi cases by zyxzevn in Coronavirus

[–]IkeConn 1 insightful - 1 fun1 insightful - 0 fun2 insightful - 1 fun -  (0 children)

CNN squashed that story.

One in three Covid patients may have caught virus in hospital — making lockdown ‘difficult to justify’ by jet199 in Coronavirus

[–]IkeConn 1 insightful - 1 fun1 insightful - 0 fun2 insightful - 1 fun -  (0 children)

This gives me church lady schadenfreude.

Robert F Kennedy, Jr. Explains Why They're Going After the Kids -- And It's Not What You Think (VIDEO) by doginventer in Coronavirus

[–]doginventer[S] 3 insightful - 2 fun3 insightful - 1 fun4 insightful - 2 fun -  (0 children)

Robert F Kennedy, Jr. Explains Why They're Going After the Kids -- And It's Not What You Think (VIDEO) https://www.thegatewaypundit.com/2021/12/robert-f-kennedy-jr-explains-going-kids-not-think-video/

The PREP Act provides immunity from liability for the COVID-19 vaccinators. The purpose of the law is to protect Big Pharma.

Robert F. Kennedy recently revealed why Big Pharma and Dr. Fauci are going after the children and babies. Because the vaccines that are recommended for children get liability protection.

Robert F. Kennedy, Jr: “They are never going to market a vaccine, allow people access to a vaccine, an approved vaccine without getting liability protection. Now the emergency use authorization vaccines have liability protection under the PREP Act and under the CARES Act.

So as long as you take an emergency use vaccine, you can’t sue them. Once they get approved, now you can sue them, unless they can get it recommended for children. Because all vaccines that are recommended, officially recommended for children get liability protection, even if an adult gets that vaccine. That’s why they are going after the kids. They know this is going to kill and injure a huge number of children, but they need to do it for the liability protection.”

Maskless COVID Cultist Oprah Winfrey and Family Celebrate Christmas Feast In Mansion Alongside Masked Servants by [deleted] in Coronavirus

[–]IkeConn 1 insightful - 1 fun1 insightful - 0 fun2 insightful - 1 fun -  (0 children)

Those masked servants farted on her family every chance they got.

COVID Antiviral Pills Cause Life-Threatening Reactions With Many Common Meds by Questionable in Coronavirus

[–]IkeConn 2 insightful - 1 fun2 insightful - 0 fun3 insightful - 1 fun -  (0 children)

Are they actively trying to kill us or is it totally profit driven mismanagement?

One in three Covid patients may have caught virus in hospital — making lockdown ‘difficult to justify’ by jet199 in Coronavirus

[–]JasonCarswell 2 insightful - 2 fun2 insightful - 1 fun3 insightful - 2 fun -  (0 children)

It wouldn't surprise me if they put him on Remdesivir.

One in three Covid patients may have caught virus in hospital — making lockdown ‘difficult to justify’ by jet199 in Coronavirus

[–]Popper 2 insightful - 2 fun2 insightful - 1 fun3 insightful - 2 fun -  (0 children)

yeah sounds like it wasn't really covid that killed him, or if it was they caused it by illegally keeping him

One in three Covid patients may have caught virus in hospital — making lockdown ‘difficult to justify’ by jet199 in Coronavirus

[–]JasonCarswell 2 insightful - 2 fun2 insightful - 1 fun3 insightful - 2 fun -  (0 children)

74 yo health problems and co-morbidities. They don't tell me much. I wrote about it last year...
/s/CriticalThoughts/comments/7f6v/dr_david_james_carswell_my_father_died_of_covid/

One in three Covid patients may have caught virus in hospital — making lockdown ‘difficult to justify’ by jet199 in Coronavirus

[–]Popper 2 insightful - 2 fun2 insightful - 1 fun3 insightful - 2 fun -  (0 children)

why did he go to the hospital in the first place?

One in three Covid patients may have caught virus in hospital — making lockdown ‘difficult to justify’ by jet199 in Coronavirus

[–]JasonCarswell 1 insightful - 2 fun1 insightful - 1 fun2 insightful - 2 fun -  (0 children)

Last New Years my dad went in the hospital for a week. He came back with COVID and gave it to my mom. They went to 2 different hospitals. He was in a coma for 3 weeks on a ventilator and died, "with COVID". She made it out alive and want's to blame me for pointing out the entire rigged system is bullshit.

Doctors given license to murder COVID patients in New Zealand by trident765 in Coronavirus

[–]jet199 1 insightful - 1 fun1 insightful - 0 fun2 insightful - 1 fun -  (0 children)

I'm starting to stop feeling sorry for these countries and starting to think back on that old English saying.

People get the politicians they deserve